Human Variation And Race

1) The environmental stress that I choose is heat. Very high levels of heat can cause hyperthermia and therfore, negatively inpacting the survival of humans. Extremely high temperatures can cause lack of bodily fluids which leads to dehydration. If those temperatures continue for a few days, the internal organs of a human will start to deteriate and this will cause death.

2) There are four ways we have adapted to the heat stress and they are as follows:

a. We sweat through small pores in our skin to cool off our body. This helps to regulate our internal temperature so that we could servive in extreme heat.

b. Our skin tends to get darker to adapt to the heat stress. Melanin acts as a protective biological shield against ultraviolet radiation. It helps to prevent sunburn damage and DNA changes that can cause skin cancer.

c. Our bodies change in shape to adapt to the heat stress. Our bodies get tall, slender, and have longer limbs to assist in the loss of body heat.


d. Our bodies adapted to different diets to be able to coupe with the heat stress. We most often eat cold desserts and fresh foods during hot climates.

       　

3) The benefits of studying human variation across environmental clines are to let us know why our skin is dark, our eyes are the color they are, and many other traits. Information like this is useful and can help us figure out ways to protect us from many environmental factors. One example could be to figure out ways for our body not to dehydrate in extreme heat besides drinking fluids.

4) The ways I would use race to understand the heat adaptation would be to notify people that the skin color is a way for a human to coupe with the ultraviolet rays produced by the sun. The study of environmental adaptation is a better way to understand human variation than race because it explains to us different environmental factors that we have to coupe with to be able to survive. For example, our skin gets darker the closer one lives to the equater and this is to coupe with heat and to avoid sun damage to our skin.
　
　
　
　

Piltdown Hoax

In the early 1900's, a laborer was digging at Barkham Manor near the village of Piltdown, when he discovered a piece of skull. This took place in Sussex, a rural county in southeast England. The piece of skull was given to an archaeologist by the name of Charles Dawson. During this time they were in search of the missing link, which was considered to be half human and half ape. On the 18th of December of 1912, Sir Arthur Woodward and Charles Dawson presented mankinds early ancestor to the word. In the year 1912, this was a very big deal because little was known about human fossils. the piltdown man was nicknamed "the earliest Englishman." The finding was made world news and the small town of Piltdown became the most famous place on earth. Piltdown man was placed in London's Natural History Museum.

The fault that came into play in this scenairo is that they got two excited and went looking for more. This in return brought doubts to the people. The people doubted if the skull really matched the jawbone that was found in the same place. Fourty years later it was found that the skull was a fake and the scientist were embarresed. The British scientist felt fooled for believing in this for so long.

It was in the museum were Kenneth Oakley applied a chemical test to help date the fossil. It turned out to be that the fossil dated much younger than expected. The test were carried to estimate the nitrogen content and in fact it did prove that it was not a human skull. The teeth had been filed down and stained. The key discovery was one canine tooth that was filed down in a rush and colored with paint.

I don't think it is possible to remove the human factor from science. Us humans are the most curious on discovering new things and as well as becoming great historians. We want to be the center of attention and the oportunity lies on discovering new things.

The lesson that we are given is that envy can overpower us only for a short period of time. My mother always states that the truth will always come to light. Sometimes it comes later, but it always comes when you least expect it. We must be very careful and always have a lot of evidence to back up our theories.

Analogy/Homology Blog Post

1) Homology

a.  A dolphin and a sheep have the same skeletal structure, eventhough, one is adapted for swimming and the other for running.

b. The majority of tetrapods have the same forelimb bone arrangement: one arm bone (humerus), two forearm bones (radius and ulna), a number of wrist (carpal) bones and five metacarpals (located in the palm) joined to five sets of phalanges (bones of the fingers).

c. I believe that the common ancestor could have been a reptile. A reptile can be adapted for both water and land thus creating these two animals. 

 

       

2) Analogy

a. The wings of various unrelated flying animals, such as insects and vertebrates( known as birds) resemble one another superficially, but their structures are very different.

b.  Vertebrate (bird)  wings are modified forelimbs supported by bones. Insect wings are outgrowths of the upper wall of the thorax and are supported by chitinous veins.

c. I believe that the ancestores of the bird and insect both possesed the same trait. The reason for this is because they were both designed for aviation. 

        

Protein Synthesis

ACCATACCACCCGAACGGTAGTGGCTAGAGCTTAACATCTATCCCGG

Historical Influences on Darwin

1) I believe that Thomas Malthus had the most influence over Darwin’s development of his theory of Natural selection.

2) Malthus contributed to the scientific community by coming up with the idea that plants as well as men tend to produce more offspring than can survive. As stated on the website http://www.ucmp.berkeley.edu/history/malthus.html, he blamed three elements of living conditions in the 19th century. "The overproduction of young; the inability of resources to keep up with the rising human population; and the irresponsibility of the lower classes. To combat this, Malthus suggested the family size of the lower class ought to be regulated such that poor families do not produce more children than they can support."

3) The point most directly affected by Mathus was that resources are limited. Mathus suggested that families should limit their children, this meaning that they should not have more children than they can support.

4) No, because Darwin as well found out that resources are limited and that evolution is based on survival of the fittest with the right amount of resources.

5) The church was against anything that contradicted the bible. Darwin feared the people will not like his ideas as to how the world was created. Because of this, it took Darwin 23 years to publish his book.

Scientific Method Scenario Discussion

1. It is possible that the student is lacking energy and is unable to stay awake.
2. I would test this hypothesis by having the student take a cup of cafe or any type of drink that has caffeine in it before the start of class. If the student stayed awake, this would support my hypothesis. If he fell asleep anyway, it would suggest that my hypothesis was falsified.
3. An example of an untestable, unfalsifiable explanation would be that no matter what the student is lazy and does not care about his education or about what is going on around him. The student barely has enough energy to walk around.